 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_0013255 | |||
| Gene | DPYD | Organism | Human |
| Genome Locus | chr1:97543299-97915779:- | Build | hg19 |
| Disease | Irradiated Hepatic Stellate Cell (HSC) | ICD-10 | Fibrosis and cirrhosis of liver (K74) |
| DBLink | Link to database | PMID | 28774651 |
| Experimental Method | |||
| Sample Type | LX2 Cell lines | Comparison | two cell cultural groups (normal Hepatic Stellate Cells (HSC) vs. irradiated Hepatic Stellate Cells (HSC)) |
| Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
| Primers (Experimented) | Forward GAAATGCATATTTGCCACAAAACCT ReverseTGACACCAATATGCAGCCGT | Statistics | Fold Change : Downregulated,4.818665 pvalue : p=0.032106 |
| Citation | |||
| Chen, Y, Yuan, B, Wu, Z, Dong, Y, Zhang, L, Zeng, Z (2017). Microarray profiling of circular RNAs and the potential regulatory role of hsa_circ_0071410 in the activated human hepatic stellate cell induced by irradiation. Gene, 629:35-42. | |||